Review




Structured Review

Merck & Co blt1 crispr guide rna
( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) <t>CRISPR/Cas9-mediated</t> knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and <t>blt1</t> crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .
Blt1 Crispr Guide Rna, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blt1+crispr+guide+rna/blt1/pmc08298094-36-8-6
Average 90 stars, based on 1 article reviews
blt1 crispr guide rna - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "Pioneer neutrophils release chromatin within in vivo swarms"

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

Journal: eLife

doi: 10.7554/eLife.68755

( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .
Figure Legend Snippet: ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

Techniques Used: Inverted Microscopy, Imaging, Microscopy, Infection, Injection, CRISPR

( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.
Figure Legend Snippet: ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

Techniques Used: Expressing, CRISPR, Injection

( A ) The percentage of larvae with neutrophil swarms at 3 hr post injury after gasdermin inhibitor, LDC7559, or DMSO treatment. Data shown are mean with a minimum of 120 larvae analysed in each group, accumulated from three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( B ) The percentage of larvae with neutrophil swarms at 4 hr post injury after neutrophil elastase inhibitor, MeOSu-AAPV-CMK, treatment, or DMSO control. Data shown are mean, with greater than 73 larvae per group over three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( C ) Representative fluorescence micrographs of the double transgenic Tg(mpx:GFP);Tg(lyz:nfsβ-mCherry) after myeloperoxidase knockdown using CRISPR-Cas9 with tyrosinase knockdown as a negative control. The myeloperoxidase guide RNA targeted the promoter of mpx , therefore knocking down expression of green mpx:GFP while leaving lyz:mCherry intact. White arrowhead indicates the presence of a swarm at the wound (white dashed line). ( D ) The percentage of larvae with neutrophil swarms at 4 hr post-injury after mpx knockdown by CRISPR-Cas9 or tyr control. Data shown are mean, with a minimum of 115 larvae analysed in each group, accumulated from three biological replicates . Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups. p-values in ( A ), ( C ), and ( D ) are generated from unpaired t-tests. Figure 7—source data 1. Numerical data for the graph of . Figure 7—source data 2. Numerical data for the graph of . Figure 7—source data 3. Numerical data for the graph of .
Figure Legend Snippet: ( A ) The percentage of larvae with neutrophil swarms at 3 hr post injury after gasdermin inhibitor, LDC7559, or DMSO treatment. Data shown are mean with a minimum of 120 larvae analysed in each group, accumulated from three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( B ) The percentage of larvae with neutrophil swarms at 4 hr post injury after neutrophil elastase inhibitor, MeOSu-AAPV-CMK, treatment, or DMSO control. Data shown are mean, with greater than 73 larvae per group over three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( C ) Representative fluorescence micrographs of the double transgenic Tg(mpx:GFP);Tg(lyz:nfsβ-mCherry) after myeloperoxidase knockdown using CRISPR-Cas9 with tyrosinase knockdown as a negative control. The myeloperoxidase guide RNA targeted the promoter of mpx , therefore knocking down expression of green mpx:GFP while leaving lyz:mCherry intact. White arrowhead indicates the presence of a swarm at the wound (white dashed line). ( D ) The percentage of larvae with neutrophil swarms at 4 hr post-injury after mpx knockdown by CRISPR-Cas9 or tyr control. Data shown are mean, with a minimum of 115 larvae analysed in each group, accumulated from three biological replicates . Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups. p-values in ( A ), ( C ), and ( D ) are generated from unpaired t-tests. Figure 7—source data 1. Numerical data for the graph of . Figure 7—source data 2. Numerical data for the graph of . Figure 7—source data 3. Numerical data for the graph of .

Techniques Used: Fluorescence, Transgenic Assay, CRISPR, Negative Control, Expressing, Generated


Figure Legend Snippet:

Techniques Used: Transgenic Assay, Infection, CRISPR, Sequencing, Recombinant, Plasmid Preparation, Software

Related Articles

CRISPR:

Article Title: Pioneer neutrophils release chromatin within in vivo swarms
Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG). .. Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG). .. Other , mpx Synthetic SynRNA , Merck , mpx CRISPR guide RNA , GTTGTGCTGAATGTATGCAG(CGG).



Similar Products

90
Merck & Co blt1 crispr guide rna
( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) <t>CRISPR/Cas9-mediated</t> knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and <t>blt1</t> crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .
Blt1 Crispr Guide Rna, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blt1+crispr+guide+rna/blt1/pmc08298094-36-8-6
Average 90 stars, based on 1 article reviews
blt1 crispr guide rna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Inverted Microscopy, Imaging, Microscopy, Infection, Injection, CRISPR

( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Expressing, CRISPR, Injection

( A ) The percentage of larvae with neutrophil swarms at 3 hr post injury after gasdermin inhibitor, LDC7559, or DMSO treatment. Data shown are mean with a minimum of 120 larvae analysed in each group, accumulated from three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( B ) The percentage of larvae with neutrophil swarms at 4 hr post injury after neutrophil elastase inhibitor, MeOSu-AAPV-CMK, treatment, or DMSO control. Data shown are mean, with greater than 73 larvae per group over three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( C ) Representative fluorescence micrographs of the double transgenic Tg(mpx:GFP);Tg(lyz:nfsβ-mCherry) after myeloperoxidase knockdown using CRISPR-Cas9 with tyrosinase knockdown as a negative control. The myeloperoxidase guide RNA targeted the promoter of mpx , therefore knocking down expression of green mpx:GFP while leaving lyz:mCherry intact. White arrowhead indicates the presence of a swarm at the wound (white dashed line). ( D ) The percentage of larvae with neutrophil swarms at 4 hr post-injury after mpx knockdown by CRISPR-Cas9 or tyr control. Data shown are mean, with a minimum of 115 larvae analysed in each group, accumulated from three biological replicates . Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups. p-values in ( A ), ( C ), and ( D ) are generated from unpaired t-tests. Figure 7—source data 1. Numerical data for the graph of . Figure 7—source data 2. Numerical data for the graph of . Figure 7—source data 3. Numerical data for the graph of .

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet: ( A ) The percentage of larvae with neutrophil swarms at 3 hr post injury after gasdermin inhibitor, LDC7559, or DMSO treatment. Data shown are mean with a minimum of 120 larvae analysed in each group, accumulated from three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( B ) The percentage of larvae with neutrophil swarms at 4 hr post injury after neutrophil elastase inhibitor, MeOSu-AAPV-CMK, treatment, or DMSO control. Data shown are mean, with greater than 73 larvae per group over three biological replicates. Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups . ( C ) Representative fluorescence micrographs of the double transgenic Tg(mpx:GFP);Tg(lyz:nfsβ-mCherry) after myeloperoxidase knockdown using CRISPR-Cas9 with tyrosinase knockdown as a negative control. The myeloperoxidase guide RNA targeted the promoter of mpx , therefore knocking down expression of green mpx:GFP while leaving lyz:mCherry intact. White arrowhead indicates the presence of a swarm at the wound (white dashed line). ( D ) The percentage of larvae with neutrophil swarms at 4 hr post-injury after mpx knockdown by CRISPR-Cas9 or tyr control. Data shown are mean, with a minimum of 115 larvae analysed in each group, accumulated from three biological replicates . Joined data represent each individual experiment using larvae from the same zebrafish lay over the two treatment groups. p-values in ( A ), ( C ), and ( D ) are generated from unpaired t-tests. Figure 7—source data 1. Numerical data for the graph of . Figure 7—source data 2. Numerical data for the graph of . Figure 7—source data 3. Numerical data for the graph of .

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Fluorescence, Transgenic Assay, CRISPR, Negative Control, Expressing, Generated

Journal: eLife

Article Title: Pioneer neutrophils release chromatin within in vivo swarms

doi: 10.7554/eLife.68755

Figure Lengend Snippet:

Article Snippet: Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).

Techniques: Transgenic Assay, Infection, CRISPR, Sequencing, Recombinant, Plasmid Preparation, Software